|
Left Crispr |
Right Crispr |
| Crispr ID |
1140879762 |
1140879772 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
16:79187523-79187545
|
16:79187569-79187591
|
| Sequence |
CCCAAGTAGCTGGGACTACAGGC |
CACGCCCAGCTGATTTTTAGTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 29903, 1: 154936, 2: 253675, 3: 221513, 4: 364385} |
{0: 1, 1: 2, 2: 27, 3: 127, 4: 443} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|