ID: 1140881308_1140881315

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1140881308 1140881315
Species Human (GRCh38) Human (GRCh38)
Location 16:79200315-79200337 16:79200355-79200377
Sequence CCCGCTCTCAGATCTGAGGCCAG TGATTCTGGGGTGCTACAAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 257} {0: 1, 1: 0, 2: 0, 3: 14, 4: 111}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!