ID: 1141000477_1141000490

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1141000477 1141000490
Species Human (GRCh38) Human (GRCh38)
Location 16:80302883-80302905 16:80302932-80302954
Sequence CCCCACCCAAATCTCATCTTGAA CATGAGAGGGACCCCGTGGGAGG
Strand - +
Off-target summary No data {0: 1, 1: 71, 2: 859, 3: 1963, 4: 3852}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!