ID: 1141031051_1141031060

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1141031051 1141031060
Species Human (GRCh38) Human (GRCh38)
Location 16:80588971-80588993 16:80588988-80589010
Sequence CCAGCACCTTCCCCAGGCTGTGA CTGTGATAGGGGCAAGAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 10, 3: 53, 4: 474} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!