|
Left Crispr |
Right Crispr |
Crispr ID |
1141033106 |
1141033117 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
16:80606704-80606726
|
16:80606736-80606758
|
Sequence |
CCATAGTTCCCACATGTTGTGGG |
GTGGGAGATAATTCAATGACGGG |
Strand |
- |
+ |
Off-target summary |
{0: 8, 1: 746, 2: 2049, 3: 3618, 4: 4354} |
{0: 1, 1: 1, 2: 175, 3: 1916, 4: 6433} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|