|
Left Crispr |
Right Crispr |
| Crispr ID |
1141033110 |
1141033117 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
16:80606712-80606734
|
16:80606736-80606758
|
| Sequence |
CCCACATGTTGTGGGAGGGACCC |
GTGGGAGATAATTCAATGACGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 735, 1: 2330, 2: 4046, 3: 5075, 4: 5145} |
{0: 1, 1: 1, 2: 175, 3: 1916, 4: 6433} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|