ID: 1141043719_1141043722

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1141043719 1141043722
Species Human (GRCh38) Human (GRCh38)
Location 16:80695110-80695132 16:80695132-80695154
Sequence CCAAATCTGGCCAGATGTTTGTT TTTTGGAAGTAAAGTTTTATTGG
Strand - +
Off-target summary No data {0: 1, 1: 51, 2: 912, 3: 1476, 4: 1979}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!