ID: 1141044343_1141044347

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1141044343 1141044347
Species Human (GRCh38) Human (GRCh38)
Location 16:80703113-80703135 16:80703139-80703161
Sequence CCATGTAGAATATGCACATACAC CACCTGGGCAAAAAGAGAGGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 20, 4: 200} {0: 1, 1: 1, 2: 2, 3: 40, 4: 333}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!