ID: 1141045192_1141045197

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1141045192 1141045197
Species Human (GRCh38) Human (GRCh38)
Location 16:80709707-80709729 16:80709754-80709776
Sequence CCTTCTCACATCTACTTCCACAG TAAAGTGCCACATTTATTGTAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 26, 4: 304} {0: 1, 1: 0, 2: 2, 3: 23, 4: 207}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!