ID: 1141045866_1141045874

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1141045866 1141045874
Species Human (GRCh38) Human (GRCh38)
Location 16:80715755-80715777 16:80715788-80715810
Sequence CCTGCCCCTTCACCTTCCATCTC TCTGCCCTGCAGCCACTCTATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 10, 3: 79, 4: 917} {0: 1, 1: 0, 2: 1, 3: 20, 4: 257}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!