ID: 1141045867_1141045878

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1141045867 1141045878
Species Human (GRCh38) Human (GRCh38)
Location 16:80715759-80715781 16:80715800-80715822
Sequence CCCCTTCACCTTCCATCTCCTCC CCACTCTATGGAATCATCCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 20, 3: 223, 4: 1917} {0: 1, 1: 0, 2: 1, 3: 11, 4: 103}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!