ID: 1141046691_1141046701

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1141046691 1141046701
Species Human (GRCh38) Human (GRCh38)
Location 16:80721864-80721886 16:80721914-80721936
Sequence CCTCTCCCCAAACTCACTGAACC TTCCAGGCACAGCGACGAAGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 5, 4: 103}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!