ID: 1141051992_1141051993

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1141051992 1141051993
Species Human (GRCh38) Human (GRCh38)
Location 16:80775441-80775463 16:80775468-80775490
Sequence CCTTTTTCAAGGGGGGTGGGTTG AATTAATTAATTCTAGACATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 14, 4: 119} {0: 1, 1: 0, 2: 8, 3: 60, 4: 530}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!