ID: 1141066172_1141066175

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1141066172 1141066175
Species Human (GRCh38) Human (GRCh38)
Location 16:80915848-80915870 16:80915864-80915886
Sequence CCAACAGGAAGCACATGCAGGTG GCAGGTGACCACAGGGTAGAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 44, 4: 279} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!