|
Left Crispr |
Right Crispr |
| Crispr ID |
1141108780 |
1141108786 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
16:81255029-81255051
|
16:81255065-81255087
|
| Sequence |
CCTCTGGGCCTCTCAAACTGCTG |
GAGCCATTGCACCTGGCCCCAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 3, 2: 235, 3: 3378, 4: 4905} |
{0: 2, 1: 32, 2: 228, 3: 883, 4: 2343} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|