ID: 1141112388_1141112398

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1141112388 1141112398
Species Human (GRCh38) Human (GRCh38)
Location 16:81281018-81281040 16:81281057-81281079
Sequence CCCAGAGGCCTCTTTACATAATA GGACAAGGGCCAAAAAGGAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 158} {0: 1, 1: 0, 2: 1, 3: 29, 4: 287}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!