|
Left Crispr |
Right Crispr |
Crispr ID |
1141132488 |
1141132502 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
16:81445252-81445274
|
16:81445304-81445326
|
Sequence |
CCAGCAGCTCGGGCGGCGGCGGC |
GCTGCTGGGGGGCGACGTGTCGG |
Strand |
- |
+ |
Off-target summary |
{0: 1, 1: 1, 2: 11, 3: 163, 4: 5978} |
{0: 1, 1: 0, 2: 0, 3: 9, 4: 130} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|