ID: 1141132492_1141132502

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1141132492 1141132502
Species Human (GRCh38) Human (GRCh38)
Location 16:81445278-81445300 16:81445304-81445326
Sequence CCCCGGCAGATCGAGGAGACCAA GCTGCTGGGGGGCGACGTGTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 46} {0: 1, 1: 0, 2: 0, 3: 9, 4: 130}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!