ID: 1141133750_1141133755

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1141133750 1141133755
Species Human (GRCh38) Human (GRCh38)
Location 16:81452385-81452407 16:81452414-81452436
Sequence CCTCCATTCAGCAGTTAAGTGTC CTAGGCACTCGGAAGAAAACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 99} {0: 1, 1: 0, 2: 0, 3: 10, 4: 104}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!