ID: 1141151792_1141151800

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1141151792 1141151800
Species Human (GRCh38) Human (GRCh38)
Location 16:81569435-81569457 16:81569455-81569477
Sequence CCCTGGCTCTCCCAGAGGGACAT CATGGCACTGGCTGGGCCTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 180} {0: 1, 1: 1, 2: 3, 3: 45, 4: 370}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!