ID: 1141153229_1141153242

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1141153229 1141153242
Species Human (GRCh38) Human (GRCh38)
Location 16:81579155-81579177 16:81579208-81579230
Sequence CCCTGCCTCCTAGGGCTATTGCA AGGAGGAAGATGAAGGTGAAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 21, 4: 186} {0: 1, 1: 0, 2: 10, 3: 204, 4: 1939}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!