ID: 1141158577_1141158581

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1141158577 1141158581
Species Human (GRCh38) Human (GRCh38)
Location 16:81613646-81613668 16:81613672-81613694
Sequence CCATGATCATTTTTAGAGTCTTA AAATACAGTTTGGGGAAGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 315} {0: 1, 1: 0, 2: 5, 3: 36, 4: 397}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!