ID: 1141183946_1141183951

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1141183946 1141183951
Species Human (GRCh38) Human (GRCh38)
Location 16:81773872-81773894 16:81773903-81773925
Sequence CCTTTTTGTGTTCCTCCAACTAC CCCATCATGCAGGACTTTGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 223} {0: 1, 1: 0, 2: 0, 3: 33, 4: 454}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!