ID: 1141199120_1141199123

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1141199120 1141199123
Species Human (GRCh38) Human (GRCh38)
Location 16:81883570-81883592 16:81883597-81883619
Sequence CCTCTTTTGAAGGCACACATTGA GAGAAGACTGAGAAGATGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 163} {0: 1, 1: 0, 2: 7, 3: 51, 4: 441}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!