ID: 1141220577_1141220585

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1141220577 1141220585
Species Human (GRCh38) Human (GRCh38)
Location 16:82065708-82065730 16:82065733-82065755
Sequence CCCAAACCTCCCTTCTCTGCTGA CAGATGAAGGAGAAGGTGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 328} {0: 1, 1: 0, 2: 5, 3: 62, 4: 584}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!