ID: 1141220580_1141220585

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1141220580 1141220585
Species Human (GRCh38) Human (GRCh38)
Location 16:82065717-82065739 16:82065733-82065755
Sequence CCCTTCTCTGCTGACACAGATGA CAGATGAAGGAGAAGGTGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 260} {0: 1, 1: 0, 2: 5, 3: 62, 4: 584}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!