ID: 1141278901_1141278903

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1141278901 1141278903
Species Human (GRCh38) Human (GRCh38)
Location 16:82613043-82613065 16:82613060-82613082
Sequence CCAACCACAGCTTCAGAAGAAAG AGAAAGCCCTCCTGTCTCCAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 5, 3: 24, 4: 293}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!