ID: 1141284691_1141284700

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1141284691 1141284700
Species Human (GRCh38) Human (GRCh38)
Location 16:82660562-82660584 16:82660599-82660621
Sequence CCAGAGATGAAGTGAAAGAAAGA CCAGGAGGGAAGCTTCCAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 49, 4: 729} {0: 1, 1: 1, 2: 5, 3: 36, 4: 327}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!