ID: 1141301025_1141301030

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1141301025 1141301030
Species Human (GRCh38) Human (GRCh38)
Location 16:82815714-82815736 16:82815754-82815776
Sequence CCCCTAATCGTAGACTATCACTT TGTCCACCCATTATACTGTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 39} {0: 1, 1: 0, 2: 0, 3: 10, 4: 91}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!