ID: 1141309948_1141309950

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1141309948 1141309950
Species Human (GRCh38) Human (GRCh38)
Location 16:82903812-82903834 16:82903827-82903849
Sequence CCATGTTTCGTAAATAAGAGCAC AAGAGCACTGAGGTTGAGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 80} {0: 1, 1: 1, 2: 10, 3: 90, 4: 734}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!