ID: 1141324061_1141324069

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1141324061 1141324069
Species Human (GRCh38) Human (GRCh38)
Location 16:83039103-83039125 16:83039135-83039157
Sequence CCATGGCCCAGGTTCCCACGGAG GGCCACAGGCTATATACGCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 35, 4: 221} {0: 1, 1: 0, 2: 1, 3: 2, 4: 44}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!