ID: 1141336071_1141336076

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1141336071 1141336076
Species Human (GRCh38) Human (GRCh38)
Location 16:83156591-83156613 16:83156614-83156636
Sequence CCTCCAGATAAAAGGCACCATGG GCAGCTAACAAGCCCCTAATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 150} {0: 1, 1: 1, 2: 0, 3: 7, 4: 51}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!