ID: 1141338969_1141338972

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1141338969 1141338972
Species Human (GRCh38) Human (GRCh38)
Location 16:83185125-83185147 16:83185159-83185181
Sequence CCTAAGGGTCCTACAGCTGGTCG AGATTTGTATCCAAGCAGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 59} {0: 1, 1: 0, 2: 7, 3: 39, 4: 351}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!