ID: 1141382369_1141382380

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1141382369 1141382380
Species Human (GRCh38) Human (GRCh38)
Location 16:83588021-83588043 16:83588053-83588075
Sequence CCTCCTTCCATCCCGTACACCTG GGCTGGCCTAGGGCTGAGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 195} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!