|
Left Crispr |
Right Crispr |
| Crispr ID |
1141397604 |
1141397608 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
16:83718749-83718771
|
16:83718789-83718811
|
| Sequence |
CCCCTAGCTTCTGCAGCTATTTC |
AATCATGTGAAACTACTGCCTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 7, 1: 13, 2: 28, 3: 44, 4: 216} |
{0: 2, 1: 2, 2: 38, 3: 65, 4: 169} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|