ID: 1141400487_1141400496

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1141400487 1141400496
Species Human (GRCh38) Human (GRCh38)
Location 16:83742876-83742898 16:83742915-83742937
Sequence CCTCCTTGAGGTCTCCCATGGGA ATAAGCAAACTGGCCAGGTGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 203} {0: 1, 1: 1, 2: 48, 3: 1005, 4: 3985}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!