ID: 1141426539_1141426548

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1141426539 1141426548
Species Human (GRCh38) Human (GRCh38)
Location 16:83947859-83947881 16:83947895-83947917
Sequence CCCCAACACTCCACGTTGGCAGG TGGGGAAACCGAGGCTCAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 80} {0: 6, 1: 32, 2: 235, 3: 770, 4: 1758}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!