ID: 1141429180_1141429192

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1141429180 1141429192
Species Human (GRCh38) Human (GRCh38)
Location 16:83962151-83962173 16:83962204-83962226
Sequence CCTGCCCCATCATGGCCACCCTA AGATGGGTCTCAGTTAATTTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 251} {0: 1, 1: 5, 2: 33, 3: 74, 4: 279}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!