ID: 1141438719_1141438723

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1141438719 1141438723
Species Human (GRCh38) Human (GRCh38)
Location 16:84015629-84015651 16:84015676-84015698
Sequence CCTACGTCAAGAATGTCCATCAG CTGCTAATAAAGACCTACCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 79} {0: 1, 1: 2, 2: 85, 3: 158, 4: 193}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!