ID: 1141455592_1141455601

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1141455592 1141455601
Species Human (GRCh38) Human (GRCh38)
Location 16:84139606-84139628 16:84139642-84139664
Sequence CCTTTGTGGCAATTTGTTACATC AAGGATAAACAGTGGGAGGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 4, 3: 73, 4: 789}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!