ID: 1141463273_1141463281

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1141463273 1141463281
Species Human (GRCh38) Human (GRCh38)
Location 16:84191044-84191066 16:84191089-84191111
Sequence CCTTCCCATTGGCAGGGTGCACT CTCATTGGCCATCGTATGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 134} {0: 1, 1: 0, 2: 0, 3: 1, 4: 56}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!