ID: 1141470647_1141470653

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1141470647 1141470653
Species Human (GRCh38) Human (GRCh38)
Location 16:84236185-84236207 16:84236199-84236221
Sequence CCATGCCTCAGTTTCCTCATCTG CCTCATCTGAAAATGGAGTGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 25, 4: 247}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!