ID: 1141473854_1141473869

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1141473854 1141473869
Species Human (GRCh38) Human (GRCh38)
Location 16:84258701-84258723 16:84258746-84258768
Sequence CCCTCCCTTTGGTCCACACAGAC AACCCTTGGGGTAGGGAAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 223} {0: 1, 1: 0, 2: 2, 3: 23, 4: 353}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!