ID: 1141482837_1141482841

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1141482837 1141482841
Species Human (GRCh38) Human (GRCh38)
Location 16:84318327-84318349 16:84318344-84318366
Sequence CCTGGATGGCCCTGAGGAGGTGT AGGTGTTACAAGGTACCTGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 232} {0: 1, 1: 0, 2: 2, 3: 3, 4: 78}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!