ID: 1141496996_1141497006

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1141496996 1141497006
Species Human (GRCh38) Human (GRCh38)
Location 16:84417111-84417133 16:84417152-84417174
Sequence CCTCTCTGTGCCTCAGTTTTCTC GGTGATGCCCATAGGGTACTTGG
Strand - +
Off-target summary {0: 67, 1: 630, 2: 2405, 3: 5746, 4: 10578} {0: 1, 1: 0, 2: 1, 3: 6, 4: 68}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!