ID: 1141500766_1141500771

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1141500766 1141500771
Species Human (GRCh38) Human (GRCh38)
Location 16:84442813-84442835 16:84442835-84442857
Sequence CCCTCCACCAGCGATTCCAAAAG GAATCCTATGAGCTTCCCTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 142} {0: 1, 1: 0, 2: 1, 3: 14, 4: 135}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!