ID: 1141502817_1141502826

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1141502817 1141502826
Species Human (GRCh38) Human (GRCh38)
Location 16:84455449-84455471 16:84455479-84455501
Sequence CCTGGGCAGAAACACCCCCATCG CGGAGGTGCTCTCTAGGTTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 105} {0: 1, 1: 0, 2: 0, 3: 3, 4: 63}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!