ID: 1141503839_1141503849

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1141503839 1141503849
Species Human (GRCh38) Human (GRCh38)
Location 16:84462172-84462194 16:84462206-84462228
Sequence CCATGGGGGGCGGCAGCTGCCAG CAGCCCAGGAGGGGTCAGTGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 325} {0: 1, 1: 0, 2: 4, 3: 54, 4: 419}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!