ID: 1141504121_1141504128

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1141504121 1141504128
Species Human (GRCh38) Human (GRCh38)
Location 16:84463420-84463442 16:84463466-84463488
Sequence CCACAGGCAGGCCCTTCTGGAAC AGGAAGATCTCCCTGCCTTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 114, 4: 604} {0: 1, 1: 0, 2: 0, 3: 21, 4: 248}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!