ID: 1141517031_1141517037

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1141517031 1141517037
Species Human (GRCh38) Human (GRCh38)
Location 16:84552365-84552387 16:84552379-84552401
Sequence CCCAAATACCTCTGTGCAGACAG TGCAGACAGCGGCAGGGTAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 175} {0: 1, 1: 0, 2: 4, 3: 19, 4: 249}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!